DNA, mRNA and the Genetic Code

We have the following single strand of nucleic acid:

5'- ATGCTATCATTGACCTTGAGTTATTAA -3'

i) Is this a strand of DNA or RNA? How do you know?

Response: We know it is DNA because it is made up of the four bases that exist in DNA: AGCT. On the other hand, RNA has AGCU. Uracil replaces thymine in RNA.

ii) If DNA, what is the complementary strand?

Response: The complementary strand will run in an antiparallel fashion and will base pair according to the following rule: GC and AT.

Therefore, the complementary strand is:

3'- TACGATAGTAACTGGAACTCAATAATT -5'

iii) If this were the coding strand of a DNA molecule, what would the mRNA sequence be?

Response: To determine the mRNA sequence, we must use the base pairing rules from above except substitute U for T. Therefore, GC and AU. Once again, we must keep the strands antiparallel.

5'- AUGCUAUCAUUGACCUUGAGUUAUUAA -3'

iv) If this were the non-coding strand of a DNA molecule, what would the mRNA sequence be?

Response: To determine an mRNA from the opposite strand, we use the same rules of base pairing and logic, but start from the other end on the other strand. Therefore, the mRNA would be:

3'- UACGAUAGUAACUGGAACUCAAUAAUU -5'

v) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code!)

Response: First of all, let's determine the sequence of the protein, using the genetic code, assuming the sequence given is the coding strand. As already determined, the mRNA is:

5'- AUGCUAUCAUUGACCUUGAGUUAUUAA -3'

We look the codons up in a chart of the genetic code. To make it easy, let's separate the sequence into triplets (codons) like this:

5'- AUG CUA UCA UUG ACC UUG AGU UAU UAA -3'

Now, we look up these codons and indicate what the sequence would be. It would be:

met-leu-ser-leu-thr-leu-ser-tyr

Notice that the final codon is a stop codon.

Now, if a base was inserted right at the beginning of the sequence, it would change every amino acid in the sequence because every codon would be changed. Do it yourself and you'll see.

vi) What would happen to the reading frame if three bases were inserted/deleted? Why?

Response: If three bases were added or deleted, the reading frame would not change because you would be adding or deleting one complete codon. All other downstream codons would be correct. All that would happen would be that the resulting protein would have one amino acid added or one amino acid missing. The real problems with reading frame mutations occur when 1 or 2 bases are added or deleted.