Fill This Form To Receive Instant Help

Help in Homework
trustpilot ratings
google ratings


Homework answers / question archive / 1)Using the codon chart on the bottom of the page, list all of the codons for the amino acid arginine

1)Using the codon chart on the bottom of the page, list all of the codons for the amino acid arginine

Biology

1)Using the codon chart on the bottom of the page, list all of the codons for the amino acid arginine.

2. For the codon shown below, draw the anticodon paired to this sequence, circle the wobble position, label 5’ and 3’ ends of the anticodon and codon, and indicate which amino acid is encoded by this codon. Use the codon chart at the bottom of the page.

Codon: A A U
3. For the RNA sequence shown below, draw 3 potential reading frames, with the corresponding amino acid sequences for each listed under the reading frame.

GAUCCCAUGAGACACUAUGACUGAA

Reading Frame 1:

Reading Frame 2:

Reading Frame 3

4. Briefly list 4 key features of the Wobble Hypothesis

5. Briefly state why the mRNA sequence can predict the protein sequence, but the protein sequence cannot be used to predict mRNA sequence.

UCAG UCAG UCAG UCAG Sys Sys Arg Arg Arg Arg Ser Ser ion A Ty Ty ST ST-His His GG-Ash Ash lys lys- ssnn nnss Sec C Ser Ser Ser Ser Pro

pur-new-sol

Purchase A New Answer

Custom new solution created by our subject matter experts

GET A QUOTE

Answer Preview

4) The key features of wobble hypothesis:

a) If A comes in the third position in a codon, then it can base pair with either U(uracil) or I(hypoxanthine) in the first position of anticodon.

b) G at third position of codon can base pair with C(cytosine) or U in the first position of anticodon.

c) U at third position of codon can base pair with A(adenine), G(guanine) or I in the first position of anticodon.

d) C at third position of codon can base pair with G or I in the first position of anticodon.

5)The mRNA codon sequence is degenerate. It means that more than one codon can code for the same amino acid, just like arginine has 6 codons as we have seen in question 1.Hence if the protein sequence is given ,we cannot correctly say which codon could have coded for a particular amino acid. But if mRNA sequence is given, the protein sequence can be predicted since the codon is unambiguous. One codon will code for one and only one amino acid.

please use this google drive link to download the answer file.

https://drive.google.com/file/d/1IMwBI7eRNEQbHk4s4WoIcLMvrRwDaiYy/view?usp=sharing

note: if you have any trouble in viewing/downloading the answer from the given link, please use this below guide to understand the whole process.

https://helpinhomework.org/blog/how-to-obtain-answer-through-googledrive-link

Related Questions