Homework answers / question archive / A eukaryotic cell growth gene has the following sequence in its promoter (given coding strand): 5! GCAACGATACGATTCGATATATATATATATATACGACGACG'I'I‘ACCGATC TA 3’ a) What might happen to that section of the DNA after high exposure to UV light? Specify the location(s) (remember the complement strand also)

A eukaryotic cell growth gene has the following sequence in its promoter (given coding strand): 5! GCAACGATACGATTCGATATATATATATATATACGACGACG'I'I‘ACCGATC TA 3’ a) What might happen to that section of the DNA after high exposure to UV light? Specify the location(s) (remember the complement strand also)

Biology

Share With

A eukaryotic cell growth gene has the following sequence in its promoter (given coding strand): 5! GCAACGATACGATTCGATATATATATATATATACGACGACG'I'I‘ACCGATC TA 3’ a) What might happen to that section of the DNA after high exposure to UV light? Specify the location(s) (remember the complement strand also). What is required to ?x it? b) What might happen if it was exposed to X-rays instead? Give any speci?c region that may be more fragile? What is required to ?x it? c) What would be the consequence of high exposure to high amounts of pesticides? d) Assume this gene is getting overexpressed in cancer cells. What may be some ways to regulate it? Give more than one way and for one, give an exact sequence.