Homework answers / question archive / Volume 8, Number 1; 71-84, February 2017 http://dx

Volume 8, Number 1; 71-84, February 2017 http://dx

Sociology

Share With

Volume 8, Number 1; 71-84, February 2017 http://dx.doi.org/10.14336/AD.2016.0530 Original Article Long Non-coding RNA H19 Induces Cerebral Ischemia Reperfusion Injury via Activation of Autophagy Jue Wang, Bin Cao, Dong Han, Miao Sun, Juan Feng* Department of Neurology, Shengjing Hospital, Affiliated Hospital of China Medical University, Shen Yang, 110004, China [Received April 7, 2016; Revised May 29, 2016; Accepted May 30, 2016] ABSTRACT: Long non-coding RNA H19 (lncRNA H19) was found to be upregulated by hypoxia, its expression and function have never been tested in cerebral ischemia and reperfusion (I/R) injury. This study intended to investigate the role of lncRNA H19 and H19 gene variation in cerebral I/R injury with focusing on its relationship with autophagy activation. Cerebral I/R was induced in rats by middle cerebral artery occlusion followed by reperfusion. SH-SY5Y cells were subjected to oxygen and glucose deprivation and reperfusion (OGD/R) to simulate I/R injury. Real-time PCR, flow cytometry, immunofluorescence and Western blot were used to evaluate the level of lncRNA H19, apoptosis, autophagy and some related proteins. The modified multiple ligase reaction was used to analyze the gene polymorphism of six SNPs in H19, rs217727, rs2067051, rs2251375, rs492994, rs2839698 and rs10732516 in ischemic stroke patients . We found that the expression of lncRNA H19 was upregulated by cerebral I/R in rats, as well as by OGD/R in vitro in the cells. Inhibition of lncRNA H19 and autophagy protected cells from OGD/R-induced death, respectively.Autophagy activation induced by OGD/R was prevented by H19 siRNA. Autophagy inducer, rapamycin, abolished lncRNA H19 effect. Furthermore, we found that lncRNA H19 inhibited autophagy through DUSP5-ERK1/2 axis. The result from blood samples of ischemic patients revealed that the variation of H19 gene increased the risk of ischemic stroke. Taken together, the results of present study suggest that LncRNA H19 could be a new therapeutic target of ischemic stroke. Key words: cerebral ischemia reperfusion; lncRNA H19; gene polymorphism; autophagy; apoptosis Ischemic stroke is a serious clinic condition with poor prognosis [1]. Thrombolytic therapy is the only accepted treatment in clinic so far for ischemic stroke, which, however, unavoidably leads to the reperfusion injury. In spite of increasing effort, to deal with reperfusion injury remains a challenge for clinicians. The pathogenesis of ischemic stroke is very complex, involving both environmental and genetic factors, and a series of genetic markers of ischemic stroke have been revealed recently [2]. Long non-coding RNAs (lncRNAs) are a kind of RNAs longer than 200 nucleotides. Since they cannot be translated into proteins, lncRNAs were originally viewed as the noise of translational process. Recent studies revealed that lncRNAs participate in the regulation of protein expression through functioning as the molecular decoys, the mediators of signaling pathways, the molecular guides for transcriptional co-activators and the scaffold for the formation of functional complex [3]. LncRNA H19 expresses mainly in embryo [4]. The abnormal expression of lncRNA H19 has been found in several kinds of tumors such as gastric cancer [5], liver cancer [6], bladder cancer [6] and choriocarcinoma [7]. Recent studies reported that lncRNA H19 re-expresses in the artherosclerotic plaque [8] and animal model of coronary artery disease [9]. Hypoxia is a major cause of *Correspondence should be addressed to: Juan Feng, PhD, Department of Neurology, Shengjing Hospotal, Affiliated Hospital of China Medical University, No.36 Sanhao Street, Shenyang 110004, China. E-mail: fengjuan99999@hotmail.com. Copyright: © 2017. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ISSN: 2152-5250 71 Wang J., et al cerebral ischemia and reperfusion (I/R) injury, which can stimulate the expression of lncRNA H19 through activating hypoxia induced factor 1α [10]. However, the expression of lncRNA H19 has not been tested in cerebral I/R. Autophagy activation plays important role in the process of cerebral I/R injury, which is a double-edged sword, its activation will affect the fate of neuron suffered from I/R injury [11,12]. The formation of autophagosome helps clean up the damaged organelles and promote the recycle of energy and materials [13]. However, excessive autophagy activation will digest the substances necessary for maintaining of normal life and induce autophagic cell death including apoptosis [14]. LncRNA H19 may take part in the regulation of autophagy, since studies demonstrated that lncRNA H19 has close relationship with apoptosis [7,10]. H19 gene polymorphism participates in the regulation of lncRNA H19 expression [15], which has been reported to be associated with the risk factors of ischemic stroke, such as coronary artery disease [16], obesity [17], and blood pressure [18]. We thus speculated that the polymorphism of H19 was associated with the risk of ischemic stroke. In this study, we first employed rat middle cerebral artery occlusion (MCAO) model and human neuroblastoma cell (SH-SY5Y cell line) oxygen glucose deprivation and reperfusion (OGD/R) model to determine whether the level of lncRNA H19 is regulated by I/R challenge and, if yes, whether lncRNA H19 takes part in the regulation of autophagy and what is the underlying mechanism in the process of I/R injury. We next determined H19 gene polymorphism in the blood sample from stroke patients to test the role of H19 gene polymorphism in the regulation of lncRNA H19 expression, since it’s hard to get human brain tissue sample. METHODS AND MATERIALS Experimental animals and MCAO model The protocols for all animal experiments were approved by the Institutional Animal Care and Use Committee of China Medical University, and all studies were performed in accordance with principles outlined in the National Institutes of Health Guide for the Care and Use of Laboratory Animals. Temporary focal ischemia was induced in male Sprague–Dawley rats (250–280 g). Following anesthesia with 10% chloral hydrate (350 mg/kg, i.p.), a 4-0 monofilament nylon suture (Beijing Sunbio Biotech Co. Ltd; Beijing, China) with a rounded tip was inserted into the internal carotid artery through the external carotid artery stump, and gently advanced to Running title: LncRNA H19 in cerebral I/R injury occlude the middle cerebral artery. After a 120 min middle cerebral artery occlusion (MCAO), the suture was removed to restore blood flow. Sham-operated rats were manipulated in the same manner but without occlusion of the middle cerebral artery. The body temperature was monitored with a rectal probe and maintained at 37 ± 0.5°C with a heating pad and lamp throughout the procedure. All surgical procedures were performed under a stereomicroscope. The rats were sacrificed 24 hours after ischemia and the brains were dissected and sliced into 3-mm thick coronal sections. The sections were then stained with 4% 2,3,5-triphenyltetrazolium chloride (TTC) (Sigma; St. Louis, MO, USA) for 30 minutes, and fixed in 4% paraformaldehyde. Infarct volume was assessed on 5 slices of 3 mm coronal sections from each brain. The infarct area was estimated by Image J (Bethesda, MD, USA) software. The infarct volume was calculated using a formula: 100 × (contralateral hemisphere volume − non-infarct ipsilateral hemisphere volume) / contralateral hemisphere volume. SH-SY5Y cell culture and oxygen and glucose deprivation and reperfusion (OGD/R) treatment SH-SY5Y cells were purchased from ATCC (Maryland, America). The cells in normal group were cultured in a normal culture medium containing DMEM solution (Gibco/Life Technologies Ltd, Paisley, Scotland) mixed with 10% fetal serum (Gibco/Life Technologies Ltd, Paisley, Scotland) and 7.5% horse serum (Gibco/Life Technologies Ltd, Paisley, Scotland), and incubated in a humidified incubator (Thermo CO2 incubator, 311, USA) at 37 ? and 5% CO2. The cells in OGD group were cultured in an ischemia-mimetic solution (mmol/L: 140 NaCl, 3.5 KCl, 0.43 KH2PO4, 1.25 MgSO4, 1.7 CaCl2, 5 NaHCO3, 20 HEPES, pH 7.2-7.4) and kept in a hypoxic incubator chamber (Billups- Rothenberg) filled with 95% N2/5% CO2 at 37? for 4, 8, or 12 hr. Ten percent of intralipid solution at a concentration of 50μM was used as a vehicle (Sigma, St Louis, MO). Rapamycin (RAP) (100 nm; Sigma, R0395) and 3-methyladenine (3-MA) (400 nmol; Sigma, M9281) were used as autophagy activator and inhibitor, respectively, and added to the medium 10 min before OGD. After OGD for different time, the cells were transferred to normal culture medium and kept in an incubator with 5% CO2 at 37?for 24 hr for reperfusion and all the following experiments. Cell viability assessment The viability of SH-SY5Y cells was determined by CCK8 cell viability test kit (Dojindo, Japan, CK04). Twenty μl Aging and Disease • Volume 8, Number 1, February 2017 72 Wang J., et al CCK-8 solution was added to the culture medium per well. The absorbance value (A) was measured at 450 nm using a spectrophotometer (Thermo, multiskan FC, USA). The percentage of cell viability was calculated using the following formula: cell viability (%) = (A of experiment well/ A of control well) x 100%. Transfection of cells with H19 siRNA and DUSP5 siRNA SH-SY5Y cells were transiently transfected with small interference RNA (siRNA) against H19 or DUSP5 (GenePharma, Shang Hai, China.) using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). Briefly, after cultured in normal culture medium for 24 hr, the culture medium was replaced by normal culture medium plus 200 μl siRNA/Lipofectamine 2000 complex (10 μl siRNA, 10 μl Lipofectamine 2000 and 180 μl normal medium) and cells were incubated in a humidified incubator for 24 hr. Real-time PCR quantitative analysis Total RNA from the control and treated cells was isolated using Trizol reagent (Takara, Dalian, Liaoning Province, China). The same method was applied for isolation of total RNA from rat brain tissue which was collected from infarct surrounding area. The primer sequences used for real-time reverse transcription-PCR were as follows: The H19 upstream primer 5′-TCCCAGAACCCACAACA TGAA-3′ and reverse 5′-TTCACCTTCCAGAGCCG ATTC-3′ were used to amplify a 150 bp product; The GAPDH forward primer 5′-CTCCCATTCCTCCACC TTTG-3′, and downstream primer 5′-CCACCA CCCTGT TGCTGTAG-3′ were used to amplify a 110 bp product; The 18s forward primer 5′-CATCTCCTCCCCTATT GCCT-3′, and downstream primer 5′-CCCACACCCCT GTGTGTAGT-3′ were used to amplify a 108 bp product. RNA quantities were determined by a spectrophotometer (NanoDrop 2000, Peqlab, Erlangen, Germany). Total RNA (1.0 μg) was transcribed to cDNA using Reverse Transcriptase M-MLV and an oligo dT primer (Takara, Dalian, China). Quantitative real-time PCR was performed with SYBR premix Ex Taq (Takara) using the Rotorgene 3000 system (Corbett, Sydney, Australia). Running title: LncRNA H19 in cerebral I/R injury Immunofluorescence Immunofluorescence was used to evaluate the distribution and expression of LC3-II, Beclin1, and P62 in SH-SY5Y cells from normal control and OGD/R groups. For this purpose, the cells were incubated with antibodies against LC3 (1:800; Novus; NB600-1384), Beclin1 (1:100; Abcam Cat# ab55878) and P62 (1:100; Abcam Cat# ab91526), respectively, in a humidified container at 4°C for 12 hr. The cells were rinsed in PBS for 3 times, and incubated with TRITC conjugated anti-rabbit IgG (1:100, Proteintech) at room temperature for 4 hr. 4, 6-diamidino2-phenylindole (DAPI, 0.0001%, Sigma) was applied to stain nuclei. The cells were examined by a laser confocal microscope (Nikon D-Eclipse C1, Japan). Western Blot Total protein was extracted using a kit (KGP250; Nanjing Keygen Biotech Co. Ltd., Nanjing, China). Whole cell lysat was separated by 10-15% SDS-PAGE then transferred to a nitrocellulose membrane. The membrane was blocked with 5% skimmed milk powder in TBST (0.1% Tween 20 in TBS) for 1 hr at room temperature and incubated overnight at 4°C with antibodies against LC3II (1:500; Abcam, ab62721), Beclin1(1:1000; Abcam, ab55878), P62 (1:1000; Abcam, ab91526), DUSP5 (1:400; Abcam, Cat# ab54939 ), ERK1/2 (1:700; CST, Cat# 4695), p-ERK1/2 (1:1000; CST, Cat# 4370) and GAPDH (1:2000; Santa Cruz Biotechnology; Santa Cruz, CA, USA), followed by incubation with horseradish peroxidase-conjugated goat anti-rabbit IgG antibody (1:3000; Proteintech Group, Inc., Hubei, China). Immunoreactive bands were visualized using a chemiluminescence kit (ECL kit; Santa Cruz Biotechnology, USA), and protein bands were scanned using Chemi Imager 5500 V2.03 software. The integrated density value (IDV) for each band was calculated with a computer-aided image analysis system (Fluor Chen 2.0). The IDV of LC3II was normalized with the IDV of LC3I, while the other proteins were normalized with the IDV of GAPDH. Genotyping of H19 gene polymorphism in stroke patients Flow cytometry analysis Flow cytometry analysis was used to assess the percentage of apoptosis cells in different groups. The cells were stained with Annexin V/ PI double staining kit (DOJINDO, Japan; AD10) according to the manufacturer’s instructions. We recruited 152 patients with ischemic stroke and 150 age-and-gender-matched healthy controls from Shengjing hospital, Affiliated Hospital of China Medical University. The standards of diagnosis of ischemic stroke included that the patients came to hospital with clinical symptoms and signs of focal or global cerebral function loss, and the MRI examination showed newly occurred cerebral infarction in the clinically relevant cerebral areas. The Aging and Disease • Volume 8, Number 1, February 2017 73 Wang J., et al Running title: LncRNA H19 in cerebral I/R injury characteristics of the patients were listed in table 1. The DNA was obtained from the blood samples of the subjects using blood DNA extraction kit (TLANamp Blood DNA kit, Dp-318). The six known single nucleotide polymorphisms (SNPs) in H19, rs217727, rs2067051, rs2251375, rs492994, rs2839698 and rs10732516, were obtained through searching in the HapMap database. The polymorphisms were tested using the method of improved multiple ligation detection reaction (iMLDR). The primers were designed as follows: rs217727F: CCGTCTCCACAACTCCAACCAG; rs217727R: CCA GACCTCATCAGCCCAACAT; rs2067051F: GGGCA TACAGCGTCACCAAGTC; rs2067051R: ACCTCACC CACCGCAATTCAT; rs2251375F: TCCAGCACACGT CTCTCTCACC; rs2251375R: CCCACCCCTACTCT CCAGGAAC; rs2839698F: CCCTTCTTTCCAGCCC TAGCTC; rs2839698R: TAACGGGGGAAACTGGGG AAGT; rs4929984F: TGGGGTCCAAGTCATGACCA CT; rs4929984R: GAGGCGGTTTCACCAGGAGAAC; rs10732516F: GGTGGAACACACTGTGATCATCACA TAA; rs10732516R: GAACAATGAGGTGTCCCAGTT GCA. After multiple cycles of PCR reactions and ligase reactions, the data were collected by ABI3730XL sequencer and analyzed by GeneMapper4.1 (AppliedBiosystems, USA). This process is operated by Genesky Biotechnologies Inc., Shanghai, China. Table1. Characteristics of study subjects Characteristics Age (years) Sex (male/female) BMI (kg/m2) Smoking, n (%) Drinking, n (%) SBP (mmHg) DBP (mmHg) TC (mmol/L) TG (mmol/L) HDL-C (mmol/L) LDL-C (mmol/L) FBG (mmol/L) Hypertension, n (%) Diabetes, n (%) Hyperlipidaemia, n (%) Cases(n=152) 64.07 ± 11.81657 107/45 24.58 ± 3.014734 32.2 17.1 156.5 ± 26.34424 96.32 ± 20.7784 4.619 ± 1.230424 2.181 ± 2.04464 1.048 ± 0.273142 3.102 ± 1.040202 5.848 ± 2.253664 97 10 64 Controls(n=150) 63.68 ±9.534337 100/50 23.17 ±3.663666 16.7 19.3 128.7 ± 10.91012 84.93 ± 7.495738 4.780 ± 0.980209 1.627 ± 1.785428 1.144 ± 0.289942 2.553 ± 0.790455 5.191 ± 1.080911 12 4 57 p value 0.7657 0.4854 0.0008 < 0.0001 0.6159 < 0.0001 < 0.0001 0.2557 0.0092 0.0069 < 0.0001 0.0055 < 0.0001 0.2004 0.5589 Abbreviations: BMI, body mass index; SBP, systolic blood pressure; DBP, diastolic blood pressure; TC, total cholesterol; TG, triglyceride; HDL-C, high-density lipoprotein cholesterol; LDL-C, low-density lipoprotein cholesterol; FBG, fasting blood glucose. Statistical Analysis RESULTS All data were expressed as the mean value ± SD. Data were analyzed by one-way analysis of variance (ANOVA) followed by the Bonferroni test for multiple comparison. P-values < 0.05 were considered statistically significant. For the analysis of gene polymorphism, the categorical variables were compared using chi-square test. The Hardy-Weinberg equilibrium was evaluated by chi-square goodness-of–fit test. The additive model, dominant model and recessive model were used to compare the difference in genotype distribution between patients and controls. The strength of association between H19 polymorphism and the risk of ischemic stroke was evaluated by odds ratio (OR) and 95% confidence interval (CI). LncRNA H19 expression is upregulated by cerebral I/R and cellular OGD/R The change in lncRNA H19 expression after cerebral I/R has never been tested. To gain insight into this issue, we first examined it in a rat MCAO model. The cerebral I/R injury was proved by TTC staining, as shown in Figure 1 A, wherein the TTC stained brain slices from different groups are displayed on the left while quantification of infarct volume on the right. The level of H19 RNA accessed by Real-time PCR showed that, in sham group, the level of lncRNA H19 was very low, while cerebral I/R induced ~35 fold-increase in its expression (Fig. 1B). We Aging and Disease • Volume 8, Number 1, February 2017 74 Wang J., et al supposed that lncRNA H19 worked in neuron to exert its effect in cerebral I/R. Therefore, to verify this result and explore the underlying mechanism, we built up a cellular OGD/R model using SH-SY5Y, a neuroblastoma cell line, to mimic cerebral I/R injury. The results of CCK8 showed that 8 hr OGD and 24 hr reperfusion decreased the cell viability to about 40% with significant difference from normal control group (Fig. 1C; p