Homework answers / question archive / 1)Using the following DNA sequence, come up with your own corresponding sequence after a 1) point mutation and 2) frameshift mutation

1)Using the following DNA sequence, come up with your own corresponding sequence after a 1) point mutation and 2) frameshift mutation

Biology

Share With

1)Using the following DNA sequence, come up with your own corresponding sequence after a 1) point mutation and 2) frameshift mutation. Also write out the corresponding RNA sequence: AGTAAACGTACCTGAGACGGG

1. Explain how gene regulation in eukaryotes differs from gene regulation in prokaryotes.