Trusted by Students Everywhere
Why Choose Us?
0% AI Guarantee

Human-written only.

24/7 Support

Anytime, anywhere.

Plagiarism Free

100% Original.

Expert Tutors

Masters & PhDs.

100% Confidential

Your privacy matters.

On-Time Delivery

Never miss a deadline.

A eukaryotic cell growth gene has the following sequence in its promoter (given coding strand): 5! GCAACGATACGATTCGATATATATATATATATACGACGACG'I'I‘ACCGATC TA 3’ a) What might happen to that section of the DNA after high exposure to UV light? Specify the location(s) (remember the complement strand also)

Biology Nov 06, 2020

A eukaryotic cell growth gene has the following sequence in its promoter (given coding strand): 5! GCAACGATACGATTCGATATATATATATATATACGACGACG'I'I‘ACCGATC TA 3’ a) What might happen to that section of the DNA after high exposure to UV light? Specify the location(s) (remember the complement strand also). What is required to ?x it? b) What might happen if it was exposed to X-rays instead? Give any speci?c region that may be more fragile? What is required to ?x it? c) What would be the consequence of high exposure to high amounts of pesticides? d) Assume this gene is getting overexpressed in cancer cells. What may be some ways to regulate it? Give more than one way and for one, give an exact sequence.

Expert Solution

For detailed step-by-step solution, place custom order now.
Need this Answer?

This solution is not in the archive yet. Hire an expert to solve it for you.

Get a Quote
Secure Payment