Why Choose Us?
0% AI Guarantee
Human-written only.
24/7 Support
Anytime, anywhere.
Plagiarism Free
100% Original.
Expert Tutors
Masters & PhDs.
100% Confidential
Your privacy matters.
On-Time Delivery
Never miss a deadline.
University of California, Davis BIO SCI 2A 2A 1)When protons move through ATP synthase and generate ATP, this is an example of… !a
University of California, Davis
BIO SCI 2A 2A
1)When protons move through ATP synthase and generate ATP, this is an example of…
!a. Passive transport
!b. Facilitated diffusion
c. Active transport
!d. Both a and b are correct$
2. When dividing cells are observed under the microscope, chromosomes first become visible during:
a. G1
b. S phase
c. G2
d. The first half of M phase$
e. The second half of M phase
3. Orange vs tortoise shell vs black is an XOlinked trait. Heterozygotes (XXo)are tortoise shell, homozygotes are orange (XoXo) or black (XX). A black female cat (XX) is crossed to an orange male (XoY). What is the expected ratio of black males to black females (expressed as black males/black females)?
a. Infinity$
b. Zero
c. 1
d. 2
e. 3
1. Which of the following statements about diffusion is FALSE?
a. Diffusion rate depends on the kinetic energy of the molecules
b. In diffusion, the overall flow of molecules is from areas of high concentration to low concentration c. In diffusion, the overall flow of molecules is from areas of low concentration to high concentration$
d. Diffusion of large, charged molecules across a membrane requires a transport protein.
2. A protein that forms an ion channel across a membrane is most likely to be:
a. A peripheral protein
b. A transmembrane protein$
c. A phospholipid
e. Entirely outside the phospholipid bilayer
3. The “hydrogen hypothesis” for the origin of mitochondria differs from the “fermenting predator hypothesis” in a couple of ways. Which is NOT one of those ways:
a. One starts out with a cell with a nucleus, the other does not
b. One states that the mitochondrion was once a bacterium, the other does not$
c. One starts out with an external symbiont, the other does not
d. One begins with a predator, the other begins with an autotroph
4. Cell walls allow cells to:
a. Avoid the explosive effects of pure water$
b. Engulf and devour other cells
c. Keep small molecules out of the cell, if they are polar or charged
d. Perform cell division
e. Become multicellular
5. Members of the domains archaea and bacteria
a. have nuclei
b. have chloroplasts
c. are multicellular d. are prokaryotes$
e. are eukaryotes
6. How does the surface area to volume ratio (S/V) of a 1 mm cube compare to that of a 3 mm cube?
a. The 3 mm cube has a higher ratio
b. The ratio increases as the cube becomes larger
c. Increasing the volume increases the ratio
d. The ratio decreases as the cube becomes larger$
e. The ratio is a constant, for a cube
7. Oxygenic photosynthesis requires two different photoreaction centers because:
a. Two photons are needed to provide the power to reduce NADPH, because it is a 2 electron carrier
b. Even with the energy of a photon to excite electrons, evolution has not developed a photosystem that
can both reduce NADP+ and oxidize water$
c. Even with the energy of a photon to excite electrons, evolution has not developed a photosystem that can both oxidize NADPH and reduce 02.
d. No single photosystem can both reduce NADP+ and, at other times, perform cyclic photosynthesis.
8. A researcher transforms the pollen of wildOtype Arabidopsis with a gene that encodes a hairpin (inverted repeat) RNA that includes the sequences of the “B” gene required for floral organogenesis (see Figure 11). The synthetic gene is driven by the B gene’s promoter. The transgenic pollen is then used to fertilize a wildOtype plant. Based on the ABC model and your understanding of the effects of hairpin RNAs, you would predict the following phenotype in the flowers of the resulting transgenic plant:
a. Petal, petal, stamen, stamen b. Sepal, sepal, carpel, carpel$
c. Petal stamen, stamen, Petal
d. Sepal, carpel, Sepal, carpel
9. A researcher transforms the pollen of wildOtype Arabidopsis with a gene that encodes the “B” gene required for floral organogenesis (see Figure 11), but in this synthetic gene she has replaced the B gene’s promoter with the promoter that drives the “C” gene. The pollen is then used to fertilize a wildOtype plant. Based on the ABC model and your understanding of promoters, you would predict the following phenotype in the flowers of the resulting transgenic plant:
a. Sepal, petal, carpel, carpel
b. sepal, sepal, carpel, carpel
c. petal, petal, stamen, stamen d. Sepal, petal, Stamen, Stamen$
e. Stamen, stamen, petal, sepal
10. The gene for the major chlorophyllObinding protein (antenna protein) is encoded by the nuclear genome, but the protein functions in chloroplasts. The synthesis (translation) of the protein takes place in the...
a. chloroplast
b. nucleus
c. mitochondria
d. cytoplasm$
e. nucleolus
11. If the organism to which the cell in Figure 10 belongs is heterozygous for the W gene (genotype Ww), the following applies:
!a. If G carries WW, then H carries ww
!b. If G carries a Ww, then H carries Ww
c. If G carries WW, then H carries WW
d. If G carries no allele of W, then H carries some allele of W
!e. Both a and b are true$
12. The cell displayed in Figure 10 is in the following stage:
a. start of DNA replication (S phase) b. meiosis I$
c. meiosis II
d. mitosis I
e. mitosis II
13. A eukaryotic chromosome is typically and it is replicated .:
a. linear, from a single origin of replication b. linear, from multiple origins$
c. linear, from two terminal origins
d. circular, from a single origin
e. circular, from multiple origins
14. A gene is mutated, changing a codon from GGG (glycine) to GAG (glutamic acid). As a result, we'd predict that…
a. the protein's primary structure will change, and its tertiary structure might change$
b. the protein's primary structure will change, and its tertiary structure will too.
c. the protein's primary structure might change, and its tertiary structure might change.
d. the protein's primary structure might change, and its tertiary structure will change
e. We can't make any predictions about the protein's structure.
15. Cyanide (CNO) closely resembles molecular oxygen, and binds tightly to cytochrome C oxidase, the electron carrier that reduces O2 during respiration. Brain cells cannot ferment glucose, but have to respire to utilize glucose. Cyanide is deadly to brain cells because in its presence:
a. O2 builds up in the cell
!b. ATP cannot be synthesized from ADP
c. ADP cannot be produced from ATP
!d. NAD+ cannot be generated from NADH
!e. b and d$
16. Propane (C3H8) is considered a nonpolar molecule because a. Carbon and Hydrogen have similar electronegativities$
b. It contains no oxygen
c. It is a gas
d. It is flammable
e. It forms hydrogen bonds
17. Green plants…
!a. Perform respiration and photosynthesis
b. Just perform photosynthesis
c. Just perform respiration
!d. Have mitochondria and plastids
!e. both “a” and “d” are true.$
18. Which of these compounds would be the weakest electron acceptor? You may want to check the redox tower provided.
a. SO4O b. CO2$
c. H2S
d. Fe3+
e. NO3O
19. Which reaction would proceed, but provide the least free energy for the cell? You may want to check the redox tower provided.
a. NADH + So > NAD+ + H2S$
b. NADH + Ubiquinoneox > NAD+ + Ubiquinone red
c. H2 + S4O62O > S2O32O
d. NADH + NO3O > NO2O + NAD+
20. Both fermentation and respiration share the metabolic pathway termed “glycolysis”. They also share…
a. a step involving oxidation of pyruvate
b. a step involving reduction of pyruvate
c. oxidative phosphorylation of ATP
d. oxidation of NADH via the ETC
!e. none of the above$
21. Very early in the Earth’s history, there was no O2 in the atmosphere. For this reason…
a. The evolution of the ETC (electron transport chain) did not occur until after the evolution of oxygenic photosynthesis
b. Fermentation could not occur
c. Electrons from respiration were delivered to a different terminal acceptor$
d. Green plants were the first form of life to evolve
e. NAD+ could not be used as an oxidizing agent
22. Which of the carbon atoms below is most oxidized?
a. CH4
b. CH3OH
c. CH2O d. CO2$
e. There’s no way to tell without seeing the structures
23. A eukaryotic mRNA has the sequence: UGGUAGCAGCCGAUUGCAUGGGGCGCAUUGGCUAAAGGGCCCAAGCCUUUAACA. How many amino acids are in the polypeptide encoded by this tiny transcript?
a. 1
b. 3
c. 4
d. 5$
e. 6
24. A bacterial mRNA has the sequence: AAUUGGCCAUGC. Which of the following DNA sequences might be the gene that encodes this specific section of the RNA? THIS WAS TOO TRICKY, SO WE GAVE EVERYONE FULL POINTS
!a. 5’ AATTGGCCATGC
b. 5’ AAUUGGCCAUGC
!c. 5’ GCATGGCCAATT
d. 5’ GCAUCCGGUUAA
!e. both a and c are candidates$
!28. A mutation occurs in the MEK gene in one of your cells, changing the amino acid that is targeted for phosphorylation by Raf into an amino acid that is a “phosphomimic”O it makes the protein behave like the phosphorylated version of that protein. (see figure 9) As a result:
a. Nothing happensO that amino acid isn’t essential for the protein’s function
b. Cell division is constantly stimulated in that cell, causing it to become a tumor$
c. Cell division is shut down permanently in that cell
d. The growth factor receptor migrates to the nucleus
!29. The signal transduction pathway depicted above requires many intermediate steps before the signal reaches the final “effectors” of the response (including transcription factors). What is one advantage of having multiple steps, instead of a direct connection between the growth factor receptor and the target genes?
a. Having a greater variety of signal transduction genes involved means its less likely that a single mutation could mess up the pathway.
b. Having multiple steps allows the cell to amplify the initial signal.$
c. It’s not possible for a membraneObound receptor to also be a transcription factor.
!d. a and b are true
e. Having multiple activating steps makes it less likely that the response will be induced by accident.
30. For complete expression of the Lac operon two criteria must be met, the absence of glucose and the presence of lactose. The reason for this is:
!a. All bacteria can use glucose, so it’s best to use this up first, before another bacterium does.
!b. Glucose catabolism genes are expressed all the time; they’re part of “core metabolism”
!c. It is a waste of energy to produce proteins that are not needed, therefore, they do not turn on the Lac operon until lactose is available.
!d. a and b
!e. a, b, and c are all true$
31 In E. coli, cAMP is a signal for
a. a drop in the intracellular ATP levels$
b. a drop in the extracellular lactose levels
c. a rise in the extracellular lactose levels
d. a rise in the extracellular lactose ATP levels
e. a rise in the extracellular glucose levels
32. Leucine is an amino acid required for protein synthesis. How might the leucine biosynthetic operon be regulated?
a. Induced by leucine, by having leucine inhibit a repressor
b. Induced by leucine, by having leucine activate an activator
!c. Repressed by leucine, by having leucine activate a repressor
!d. Repressed by leucine, by having leucine inactivate an activator
!e. Both c and d would work.$
33. Male pattern baldness is an XOlinked recessive trait. It can also be observed in women, if they are homozygous for the recessive allele. If 40% of the men in a population display “male” pattern baldness, what is the expected frequency of women with “male” pattern baldness?
a. 36%
b. 40%
c. 48%
d. 16%$
e. 8%
34. The maternity plant produces plantlets (“babies”) along the edge of the leaf. Individual leaf cells divide and form somatic embryos, i.e. embryos that are not derived from zygotes. Each embryo develops into a plantlet that will fall off the leaf and grow next to the mother plant. The plant also forms seed from normal flowers, which can crossO or selfOpollinate. The genotype of the "mother" plant at the "z" locus is Zz. The most likely set of genotypes of 12 plants produced from the leaf edge of this plant is: a. all Zz$
b. 6 ZZ, 6 zz
c. 3 zz, 6 Zz, 3 ZZ
d. 3 zz, 9 ZZ
e. 1 zz, 2 Zz, 9 ZZ
35. The genotype of the "mother" maternity plant at the "z" locus is Zz. The most likely genotypes of 12 plants grown from the seeds of this selfOpollinated plant are:
a. all Zz
b. 6 ZZ, 6 zz
c. 3 zz, 6 Zz, 3 ZZ$
d. 3 zz, 9 ZZ
e. 1 zz, 2 Zz, 9 ZZ
36. In the purine nucleotide biosynthetic pathway drawn in figure 8, the numbers represent enzymes required for the synthesis of GMP and AMP. The biosynthetic pathway branches at IMP. This pathway is subject to allosteric feedback regulation. If the concentration of AMP is too high, and the concentration of GMP is too low, a good way to adjust the concentration would be to have:
a. AMP act as a negative regulator of enzyme 1
b. GMP act as a positive regulator of enzyme 2
c. AMP act as a negative regulator of enzyme 3
d. GMP act as a negative regulator of enzyme 5 e. AMP act as a negative regulator of enzyme 5$
37. What is the external source of electrons used to reduce NADP+ during oxygenic photosynthesis?
a. They are produced when sugars are oxidized
b. They are transported across the thylakoid membrane by ATP synthase c. They are extracted from water by photosystem II$
d. They are derived from metals in the environment
!e. b and c
38. In what intracellular compartment is ATP synthesized via oxidative phosphorylation?
a. The nucleus
b. The cytoplasm
c. The golgi
d. The mitochondrial intermembrane space e. The mitochondrial matrix$
39. The net movement of uncharged molecules across a membrane barrier from a lower concentration to a higher concentration can be best explained by which of the following?
a. diffusion
b. active transport$
c. osmosis
d. facilitated diffusion
e. exocytosis
40. Many infectious diseases are becoming difficult to treat because of bacterial resistance to antibiotics. Populations of bacteria can become resistant when they are exposed to an antibiotic. What is the best general explanation for how this occurs?
a) The antibiotic induces specific mutations in some of the bacteria that make them antibioticOresistant.
b. The antibiotic activates bacterial genes encoding enzymes that can destroy the antibiotic.
c. The antibiotic increases the bacterial mutation rate, so that resistant mutant bacteria are more likely to arise.
d. AntibioticOresistant mutant bacteria already present in the population survive and reproduce in the presence of the antibiotic.$
41. Which of the following statements comparing bacteria and eukaryotes is true?
a. Eukaryotic cells have a nucleus surrounded by a nuclear membrane; bacterial cells don't.$
b. Eukaryotic cells don't have cell walls; many bacterial cells do.
c. The genetic material of eukaryotic cells is DNA; the genetic material of bacteria can be either RNA or DNA.
d. Eukaryotic cells use a completely different code to specify the amino acids in proteins than bacterial cells.
42. Which of the following statements about viruses is FALSE? a. Viruses have a nucleus but no cytoplasm$
b. Viruses can reproduce only when they are inside a living host cell
c. Viruses cannot make proteins on their own
d. Some viruses use RNA rather than DNA as their genetic material
43. Using figure 1, match the building block molecule to the appropriate name.
a. 1=phospholipid, 2= nucleotide, 3= monosaccharide, 4= amino acid, 5= fatty acid$
b. 1=monosaccharide, 2=nucleotide, 3=monosaccharide, 4=amino acid, 5=phospholipid
c. 1=phospholipid, 2=monosaccharide, 3=nucleotide, 4=amino acid, 5=fatty acid
d. 1= fatty acid, 2=amino acid, 3=monosaccharide, 4=nucleotide, 5= phospholipid
e. 1=fatty acid, 2= nucleotide, 3=monosaccharide, 4=amino acid, 5= phospholipid
44. In figure 2, the four pictures represent cross sections of spherical structures composed of phospholipids. Which of these structures is most likely to form when a phospholipid is vigorously dispersed in water?
a. a$
b. b
c. c
d. d
45. Consider a short polar charged region and a short nonOpolar region in a long polypeptide chain. When dissolved in water, the polypeptide will most likely fold to form a protein in which:
a. The nonOpolar region is exposed on its surface and the polar region is interior.
b. The polar region is exposed on its surface and the nonOpolar region is interior. $
c. both the nonOpolar and the polar region are exposed on its surface.
d. both the nonOpolar region and the polar region are interior.
46. Consider the following chemical reaction: A + B O> C. In Figure 3, the dashed line represents the energetics of this reaction WITHOUT an enzyme. Which of the solid lines (a, b, c) in the diagram best represents the way the curve would look in the presence of an enzyme catalyst that increases the reaction rate?
a. A b. B$
c. C
!d. none of the above
47. If the chemical reaction A + B <O> C is at equilibrium, which of the following statements is FALSE?
a. The concentration of reactants and products will remain the same over time.
b. During a 1Ominute interval, many molecules of A and B may be converted to C, while about the same number of A and B molecules are produced by the breakdown of C.
c. The rates of both the forward and reverse reactions are zero.$
d. The free energy available from the reaction is zero.
48. The reaction catalyzed by the enzyme hexokinase (Reaction 3 in figure 4) can be thought of as the sum of Reactions 1 and 2. Reaction 1 is the breakdown of ATP to ADP, which releases energy. Reaction 2, in which glucose is phosphorylated, requires energy. When Reactions 1 and 2 are coupled in the enzyme active site, Reaction 3 will occur spontaneously because:
a. the energy required to form glucoseO6OP in Reaction 2 is less than the energy released by ATP breakdown in Reaction 1.$
b. the energy required to form glucoseO6OP in Reaction 2 is greater than the energy released by ATP breakdown in Reaction 1.
c. both Reactions 1 and 2 can occur spontaneously.
d. neither Reaction 1 or 2 can occur spontaneously alone, but both can occur spontaneously when coupled in the active site of the enzyme.
49. Which of the following substances will be least likely to diffuse through a pure phosopholipid bilayer membrane that contains no proteins?
a. sodium ion$
b. ethanol
c. water
d. oxygen
50. If green algae cells in a buffer solution containing only inorganic salts are placed in a sealed container at room temperature with excess carbon dioxide gas and exposed to light, the cells will:
a. live for many hours and multiply.$
b. live for several hours, but fail to multiply because there is no source of carbon in the buffer solution.
c. live for several hours, but fail to multiply because no oxygen is present.
d. die rapidly, because no oxygen is present.
51. The oxygen atoms in the H2O broken down during photosynthesis end up in:
a. ATP molecules generated by photosynthesis.
b. carbohydrates generated by photosynthesis.
c. molecular O2 released during photosynthesis.$
d. new H2O molecules that are produced by respiration.
52. Transcription is best represented by which of the pictures in figure 7?
a. A b. B$
c. C
d. D
53. In the presence of oxygen, cells oxidize glucose completely to carbon dioxide and water according to the chemical equation shown in figure 5. In the process, about 35 molecules of ATP are generated per molecule of glucose oxidized, so that some of the energy released by oxidation is recovered as usable chemical energy. The principal role of O2 in this process is to:
a. accept electrons released by glucose oxidation, forming H2O. $
b. supply the oxygen for CO2 production.
c. react with glucose to cleave it into smaller fragments for further oxidation.
d. participate as a reactant in generation of ATP from ADP and Pi.
54. Figure 6 shows a single replicated chromosome (consisting of two sister chromatids) just before mitosis. This chromosome contains:
a. two singleOstranded DNA molecules.
b. one doubleOstranded DNA molecule. c. two doubleOstranded DNA molecules.$
d. many doubleOstranded DNA molecules.
55. The replicated chromosome shown in figure 6 contains:
a. DNA from one of your parents in the sister chromatid on the left and DNA from the other parent in the sister chromatid on the right.
b. DNA contributions from both parents, resulting from recombination (crossing over). c. DNA from only one of your parents.$
!d. none of the above
56. Which of the following statements about DNA synthesis at the replication fork of a replicating DNA molecule is FALSE?
a. Nucleotides are added at the 3' ends of all the new strands in a replicating DNA molecule.
b. DoubleOstranded DNA synthesis requires both deoxyribonucleotides and ribonucleotides.
c. The sequence of each newly synthesized single strand is identical to that of the parental single strand that served as its template.$
d. One of the two new strands must be synthesized in fragments because the two strands have opposite directionality.
57. The human hexokinase enzyme has the same function as the bacterial hexokinase enzyme but is different in its amino acid sequence. You have obtained a mutant bacterial strain in which the gene for
hexokinase and its promoter are missing. If you introduce into your mutant strain a DNA plasmid engineered to contain the coding sequence of the human hexokinase gene, driven by the normal bacterial promoter, the resulting bacteria will now produce:
a. the bacterial form of hexokinase. b. the human form of hexokinase.$
c. a hybrid enzyme that is partly human, partly bacterial.
d. both forms of the enzyme.
58. In a certain mutant strain of bacteria, the enzyme leucylOtRNA synthetase mistakenly attaches isoleucine to leucylOtRNA 10% of the time instead of attaching leucine. These bacteria will synthesize:
a. proteins in which leucine is inserted at some positions normally occupied by isoleucine. b. proteins in which isoleucine is inserted at some positions normally occupied by leucine.$
c. no abnormal proteins, because the ribosomal translation machinery will recognize the inappropriately activated tRNAs and exclude them from the translation process.
d. no proteins, because the inappropriately activated tRNAs will block translation.
59. What is the relationship among genes, DNA, and chromosomes? a. Genes are composed of DNA and lie within chromosomes.$
b. Genes are separate entities from either DNA or chromosomes.
c. Genes are found only in chromosomes and not DNA.
d. Genes are found only in DNA and not chromosomes.
e. Chromosomes are composed of genes but not DNA.
60. Our understanding of how genes function indicates that:
a. different species of organisms use different genetic mechanisms for producing individual traits.
b. there are no interactions among genes in producing individual traits.
c. gene products can be carbohydrates, fats, or proteins.
d. genes do not produce specific products but code directly for individual traits. e. genes code for proteins, which in turn produce individual traits.$
61. An individual inherits a mutation in a gene associated with breast cancer. In which cells is this form of the gene located?
a. Only in cells of the breast where cancer occurred.
b. Only in cells of both breasts.
c. Only in those cells found in females.
d. Only in the cells of the breast and ovaries.
!e. All the cells of the individual.$
62. Mutations in DNA occur in the genomes of most organisms, including humans. What is the most important result of these mutations?
a. They produce new genes for the individual.
b. They produce new enzymes for the individual.
c. They provide a source of new cells for the individual.
d. They provide a potential source of genetic variation for future generations.$
e. They produce new chromosomes for future generations.
63. Your muscle cells, nerve cells, and skin cells have different functions because each kind of cell:
a. contains different kinds of genes.
b. is located in different areas of the body. c. activates different genes.$
d. contains different numbers of genes.
e. has experienced different mutations.
64. In cats, S (white paws) is dominant to s (no white). T (tabby, stripes) is dominant to t (solid color, here black). An SsTt cat (tabby with white paws) is crossed to an sstt cat (black). S and T are unlinked genes. What is the expected ratio of phenotypes in the next generation?
a. 1 tabby : 2 tabby with white paws :1 black
b. 3 tabby with white paws:1 black
c. 9 tabby with white paws : 3 tabby : 3 black with white paws : 1 black
d. 1 tabby with white paws : 1 tabby : 1 black with white paws : 1 black $
!e. none of the above
Expert Solution
please use this google drive link to download the answer file.
https://drive.google.com/file/d/1pqdjJe2D_i9_7XkJUE2Z4tHX94nN4A2X/view?usp=sharing
note: if you have any trouble in viewing/downloading the answer from the given link, please use this below guide to understand the whole process.
https://helpinhomework.org/blog/how-to-obtain-answer-through-google-drive-link
Archived Solution
You have full access to this solution. To save a copy with all formatting and attachments, use the button below.
For ready-to-submit work, please order a fresh solution below.





